SubtiBank SubtiBank
gltP [2018-03-21 09:31:43]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gltP [2018-03-21 09:31:43]

similar to H /glutamate symporter
locus
BSU02340
pI
8.65
mw
44.45 kDa
protein length
414 aa Sequence Blast
gene length
1242 bp Sequence Blast
function
unknown
product
similar to H /glutamate symporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    253,518 → 254,762

    The protein

    Protein family

  • View classification (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP], [protein|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|GltT]
  • Structure

  • [PDB|4KY0] the glutamate transporter of ''Thermococcus kodakarensis'', 33% identity, 68% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • available in [SW|Erhard Bremer]'s lab [Pubmed|25344233]
  • BKE02340 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
  • BKK02340 (Δ[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
  • References

  • 7751298,21821766,24013209,25344233