SubtiBank SubtiBank
gltP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltP

similar to H+/glutamate symporter, minor glyphosate transporter
locus
BSU02340
pI
8.65
mw
44.45 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
unknown
product
similar to H+/glutamate symporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    253,518 254,762

    The protein

    Catalyzed reaction/ biological activity

  • uptake of glyphosate [pubmed|30666812]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP], [protein|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|GltT]
  • Structure

  • [PDB|4KY0] the glutamate transporter of ''Thermococcus kodakarensis'', 33% identity, 68% similarity) [Pubmed|24013209]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • ADB1 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::neo trpC2 pheA1 available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs [Pubmed|25344233]
  • BP234 (''[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]''::''cat''), available in [SW|Fabian Commichau]'s lab
  • BP235 (''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''spc ''''[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]''::''cat''), available in [SW|Fabian Commichau]'s lab
  • BKE02340 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
  • BKK02340 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGAATCCCCCTTTAGA, downstream forward: _UP4_TAGAAAAAAAGAACACCTCA
  • MDB52 ([gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]::cat trpC2 pheA1 available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs [Pubmed|25344233]
  • GP2799 (''Δ''''[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP2824 (''Δ''''[gene|622856EE642C42247C658DBD57E6A18C6E81FE58|gltP]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • References

  • 7751298,21821766,24013209,25344233,30666812