SubtiBank SubtiBank
aroC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aroC

3-dehydroquinate dehydratase
locus
BSU23080
pI
4.90
mw
27.98 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
3-dehydroquinate dehydratase
essential
no
ec
4.2.1.10
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,412,706 2,413,473

    The protein

    Catalyzed reaction/ biological activity

  • 3-dehydroquinate = 3-dehydroshikimate + H2O (according to Swiss-Prot)
  • Protein family

  • type-I 3-dehydroquinase family (according to Swiss-Prot)
  • Structure

  • [PDB|1GQN] (from ''Salmonella typhi'', 55% identity, 70% similarity) [Pubmed|11976491]
  • Expression and Regulation

    Operons

    genes
    [gene|61EA842B400548A99504A40467796B983DD54634|aroC]
    description
    [Pubmed|7934830]
    view in new tab

    Biological materials

    Mutant

  • BKE23080 ([gene|61EA842B400548A99504A40467796B983DD54634|aroC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23080 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CACTCGTCTCAAATCCTTTC, downstream forward: _UP4_TAGAACAATAAAAAAACTCA
  • BKK23080 ([gene|61EA842B400548A99504A40467796B983DD54634|aroC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTCTCAAATCCTTTC, downstream forward: _UP4_TAGAACAATAAAAAAACTCA
  • References

  • 6442253,7934830