SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


3-dehydroquinate dehydratase
27.98 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
biosynthesis of aromatic amino acids
3-dehydroquinate dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,412,706 2,413,473

    The protein

    Catalyzed reaction/ biological activity

  • 3-dehydroquinate --> 3-dehydroshikimate + H2O (according to UniProt)
  • Protein family

  • type-I 3-dehydroquinase family (single member, according to UniProt)
  • Structure

  • [PDB|1GQN] (from ''Salmonella typhi'', 55% identity, 70% similarity) [Pubmed|11976491]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE23080 ([gene|61EA842B400548A99504A40467796B983DD54634|aroC]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CACTCGTCTCAAATCCTTTC, downstream forward: _UP4_TAGAACAATAAAAAAACTCA
  • BKK23080 ([gene|61EA842B400548A99504A40467796B983DD54634|aroC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCGTCTCAAATCCTTTC, downstream forward: _UP4_TAGAACAATAAAAAAACTCA
  • References

  • 6442253,7934830