SubtiBank SubtiBank
gndA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gndA

NADP-dependent phosphogluconate dehydrogenase
locus
BSU_23860
pI
5.08
mw
51.61 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
function
pentose phosphate pathway
product
NADP-dependent phosphogluconate dehydrogenase
essential
no
ec
1.1.1.44
synonyms
yqjI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    2,480,750 2,482,159

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-D-gluconate + NADP+ --> CO2 + D-ribulose 5-phosphate + NADPH (according to UniProt)
  • Protein family

  • 6-phosphogluconate dehydrogenase family (with [protein|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|YqeC] and [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ], according to UniProt)
  • Paralogous protein(s)

  • [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ]
  • Kinetic information

  • Reversible reaction [Pubmed|15231785]
  • Modification

  • phosphorylation on (Thr-15 OR Thr-17) [Pubmed|17218307]
  • Effectors of protein activity

  • inhibited by 4-phosphoerythronate (results from oxidation of erythrose-4-phosphate) [pubmed|30948730]
  • Structure

  • [PDB|2W8Z] (from ''Geobacillus stearothermophilus'', 83% identity, 92% similarity) [Pubmed|19407374]
  • Additional information

  • It contains a cysteine on the active site. The enzyme is a dimer. [Pubmed|15231785]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]-[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
    description
    [pubmed|22383849]

    regulation

  • constitutively expressed [Pubmed|15469515]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-C391 (yqjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2389 NBRP B. subtilis, Japan]
  • GP1514 (''gndA''::''kan''), available in [SW|Jörg Stülke]'s lab
  • BKE23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA
  • BKK23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA
  • Expression vectors

  • pGP1777 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • pGP1789 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP1389]) (available in [SW|Jörg Stülke]'s lab)
  • GP1408 (''gndA''-''Strep'' ''(spc)'') & GP1410 (''gndA''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1403 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • GP1408 (kan, resistance cassette exchange in GP1403), available in [SW|Jörg Stülke]'s lab
  • References

  • 17218307,19407374,15378759,15231785,26883633,30948730