gndA

NADP-dependent phosphogluconate dehydrogenase

locus: BSU_23860

pI: 5.08

mw: 51.61 kDa

protein length: 469 aa

gene length: 1410 bp

function: pentose phosphate pathway

product: NADP-dependent phosphogluconate dehydrogenase

essential: no

ec: 1.1.1.44

synonyms: yqjI

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.3|Pentose phosphate pathway]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]

Gene

Coordinates: 2,480,750 2,482,159

The protein

Catalyzed reaction/ biological activity

• 6-phospho-D-gluconate + NADP⁺ --> CO₂ + D-ribulose 5-phosphate + NADPH (according to UniProt)

Protein family

• 6-phosphogluconate dehydrogenase family (with [protein|C6CB4993032D8C2CC79A06C67925096F0AFE48CB|YqeC] and [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ], according to UniProt)

Paralogous protein(s)

• [protein|7E7187AA2DC172018A63A7B9CE48124F30311639|GntZ]

Kinetic information

• Reversible reaction [Pubmed|15231785]

Modification

• phosphorylation on (Thr-15 OR Thr-17) [Pubmed|17218307]

Effectors of protein activity

• inhibited by 4-phosphoerythronate (results from oxidation of erythrose-4-phosphate) [pubmed|30948730]

Structure

• [PDB|2W8Z] (from ''Geobacillus stearothermophilus'', 83% identity, 92% similarity) [Pubmed|19407374]

Additional information

• It contains a cysteine on the active site. The enzyme is a dimer. [Pubmed|15231785]
• belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]

Expression and Regulation

Operons

• genes: [gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
  description: [pubmed|22383849]

• genes: [gene|C87D33852F263A553CA747608E6200E4AD8344B5|polY1]-[gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]
  description: [pubmed|22383849]

  regulation

  • constitutively expressed [Pubmed|15469515]

additional information

• the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]

Biological materials

Mutant

• MGNA-C391 (yqjI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2389 NBRP B. subtilis, Japan]
• GP1514 (''gndA''::''kan''), available in [SW|Jörg Stülke]'s lab
• BKE23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA
• BKK23860 ([gene|61B7C51EB7E74226890010B61D8E41C02189A453|gndA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA

Expression vectors

• pGP1777 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
• pGP1789 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP1389]) (available in [SW|Jörg Stülke]'s lab)
• GP1408 (''gndA''-''Strep'' ''(spc)'') & GP1410 (''gndA''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

FLAG-tag construct

• GP1403 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
• GP1408 (kan, resistance cassette exchange in GP1403), available in [SW|Jörg Stülke]'s lab

References

• 17218307,19407374,15378759,15231785,26883633,30948730