SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.49 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,865,876 1,866,289

    The protein


  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation




  • expressed during [SW|sporulation ][Pubmed|22383849]
  • view in new tab

    Biological materials


  • BKE17320 ([gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCTCCTTTTCCTCGA, downstream forward: _UP4_TAGAAGGATGTTTACCGATG
  • BKK17320 ([gene|61B511C49912F1380AEE18AD300255A435F56F94|ymaF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCTCCTTTTCCTCGA, downstream forward: _UP4_TAGAAGGATGTTTACCGATG
  • References

  • 16479537,12060778,27766092