SubtiBank SubtiBank
floT [2017-12-02 18:33:39]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

floT [2017-12-02 18:33:39]

membrane-associated scaffold protein, orchestration of physiological processes in lipid microdomains, involved in the control of membrane fluidity, confers (together with YuaF) resistance to cefuroxime
55.82 kDa
protein length
509 aa Sequence Blast
gene length
1527 bp Sequence Blast
involved in the control of membrane fluidity
membrane-associated scaffold protein
yuaG, yuaH

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,180,465 → 3,181,994

    Phenotypes of a mutant

  • delayed onset of sporulation, reduced sporulation frequency
  • defect in motility [Pubmed|22753055]
  • reduced [SW|protein secretion] [Pubmed|23651456]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant does not induce [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]-dependent biofilm formation upon addition of surfactin [Pubmed|20713508]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency [Pubmed|22753055]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a [SW|sporulation] defect, due to the lack of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|22882210]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]'' mutant displays a defective growth under oxygen-limiting conditions [Pubmed|25909364]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]-dependent expression of ''[gene|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|fabF]'' and the ''[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]'' operon result in reduced membrane fluidity [Pubmed|21542858,22178969]
  • recruits [protein|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|YuaF] to focal assemblies [Pubmed|22753055]
  • controls protease activity of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|24222488]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • co-localizes with [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] and [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] in discrete foci membrane [Pubmed|20713508]
  • forms discrete focal structures in the cytoplasma membrane [Pubmed|22753055]
  • 6 foci [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] of are detected in strain 3610 [Pubmed|25909364]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed upon cell wall stress ([protein|search|SigW]) [Pubmed|9987136]
  • view in new tab

    Biological materials


  • MGNA-A213 (yuaG::erm), available at the [ NBRP B. subtilis, Japan]
  • JS152 (markerless), available in [SW|Daniel Lopez]'s lab
  • BKE31010 (Δ[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
  • BKK31010 (Δ[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
  • GFP fusion

  • GK38 (168 ''amyE''::P''floT-yfp'' (spc)), available in [SW|Daniel Lopez]'s lab
  • JS280 (3610 ''amyE::floT-gfp''(spc)), available in [SW|Daniel Lopez]'s lab
  • JS153 (3610 ''lacA::floT''-mEos2 (mls)), available in [SW|Daniel Lopez]'s lab
  • JS166 (3610 ''lacA::floT''-PAmCherry (mls)), available in [SW|Daniel Lopez]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) for FloT [Pubmed|25909364], available in [SW|Daniel Lopez]'s lab
  • References


  • 25652542
  • Original publications

  • 9987136,22753055,12107147,18763711,19383680,20713508,23651456,22178969,23249255,22882210,25635948,25909364,24222488,26297017,27362352