SubtiBank SubtiBank
floT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

floT

membrane-associated scaffold protein, orchestration of physiological processes in lipid microdomains, involved in the control of membrane fluidity, confers (together with [protein|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|YuaF]) resistance to cefuroxime
locus
BSU_31010
pI
5.14
mw
55.82 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
function
involved in the control of membrane fluidity
product
membrane-associated scaffold protein
essential
no
synonyms
yuaG,yuaH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,180,465 3,181,994

    Phenotypes of a mutant

  • delayed onset of sporulation, reduced sporulation frequency
  • defect in motility [Pubmed|22753055]
  • reduced [SW|protein secretion] [Pubmed|23651456]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant does not induce [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]-dependent biofilm formation upon addition of surfactin [Pubmed|20713508]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency [Pubmed|22753055]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT] [gene|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|floA]'' double mutant has a [SW|sporulation] defect, due to the lack of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|22882210]
  • a ''[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]'' mutant displays a defective growth under oxygen-limiting conditions [Pubmed|25909364]
  • The protein

    Catalyzed reaction/ biological activity

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]-dependent expression of ''[gene|5D5D9A544295DD9B55C75A8CF47AB19935E740C6|fabF]'' and the ''[gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]'' operon result in reduced membrane fluidity [Pubmed|21542858,22178969]
  • recruits [protein|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|YuaF] to focal assemblies [Pubmed|22753055]
  • controls protease activity of [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH] [Pubmed|24222488]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • co-localizes with [protein|11A55829B4C3E8EA434A600FF7B4102F8E5A7DCE|FloA] and [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] in discrete foci membrane [Pubmed|20713508]
  • forms discrete focal structures in the cytoplasma membrane [Pubmed|22753055]
  • 6 foci [protein|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|FloT] of are detected in strain 3610 [Pubmed|25909364]
  • Expression and Regulation

    Operons

    genes
    [gene|FFBB9B236B7D532D45FE0593B793E28E051BE7A2|yuaF]-[gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]-[gene|56345EA776E1C5664EF1F2D1AF5CE3E5F40AD442|yuaI]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed upon cell wall stress ([protein|search|SigW]) [Pubmed|9987136]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A213 (yuaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/213 NBRP B. subtilis, Japan]
  • JS152 (markerless), available in [SW|Daniel Lopez]'s lab
  • BKE31010 ([gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
  • BKK31010 ([gene|61893B4EB53FBBB9AD8BEEEFFCEFD0FC64544D6F|floT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC
  • GFP fusion

  • GK38 (168 ''amyE''::P''floT-yfp'' (spc)), available in [SW|Daniel Lopez]'s lab
  • JS280 (3610 ''amyE::floT-gfp''(spc)), available in [SW|Daniel Lopez]'s lab
  • JS153 (3610 ''lacA::floT''-mEos2 (mls)), available in [SW|Daniel Lopez]'s lab
  • JS166 (3610 ''lacA::floT''-PAmCherry (mls)), available in [SW|Daniel Lopez]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) for FloT [Pubmed|25909364], available in [SW|Daniel Lopez]'s lab
  • References

    Reviews

  • 25652542
  • Original publications

  • 9987136,22753055,12107147,18763711,19383680,20713508,23651456,22178969,23249255,22882210,25635948,25909364,24222488,26297017,27362352