You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
floT
membrane-associated scaffold protein, orchestration of physiological processes in lipid microdomains, involved in the control of membrane fluidity, confers (together with
YuaF) resistance to cefuroxime
Molecular weight
55.82 kDa
Function
control of membrane fluidity
Product
membrane-associated scaffold protein
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
3,180,465 3,181,994
Phenotypes of a mutant
delayed onset of sporulation, reduced sporulation frequencydefect in motility PubMedreduced protein secretion PubMeda floT floA double mutant does not induce KinC-dependent biofilm formation upon addition of surfactin PubMeda floT floA double mutant has a strong synthetic defect in motility, cell morphology, and transformation efficiency PubMeda floT floA double mutant has a sporulation defect, due to the lack of FtsH PubMeda floT mutant displays a defective growth under oxygen-limiting conditions PubMed The protein
Catalyzed reaction/ biological activity
Localization
membrane associated PubMedco-localizes with FloA and KinC in discrete foci membrane PubMedforms discrete focal structures in the cytoplasma membrane PubMed6 foci FloT of are detected in strain 3610 PubMed Expression and Regulation
Biological materials
Mutant
MGNA-A213 (yuaG::erm), available at the NBRP B. subtilis, JapanJS152 (markerless), available in Daniel Lopez's labBKE31010 (floT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAACBKK31010 (floT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATCAAATTCCTCCTTTT, downstream forward: _UP4_GAGTAAGGAAAGGGCAGAAC GFP fusion
GK38 (168 amyE::PfloT-yfp (spc)), available in Daniel Lopez's labJS280 (3610 amyE::floT-gfp(spc)), available in Daniel Lopez's labJS153 (3610 lacA::floT-mEos2 (mls)), available in Daniel Lopez's labJS166 (3610 lacA::floT-PAmCherry (mls)), available in Daniel Lopez's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH) for FloT PubMed, available in Daniel Lopez's lab References
Reviews
Loading
Original publications
Loading