SubtiBank SubtiBank
yteJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yteJ

stress protein
locus
BSU_29520
pI
9.00
mw
18.98 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
unknown
product
stress protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,019,533 3,020,027

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ACB7F015027A83C5D3457818A71B6F47192CEFBE|sppA]-[gene|618337D9BCD1586C5874746D1001DA3A2724E57C|yteJ]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced in response to cell wall stress ([protein|search|SigW]) [Pubmed|12207695]
  • additional information

  • self-processes its own C-termini [PubMed|24228759]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A110 (yteJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/110 NBRP B. subtilis, Japan]
  • BKE29520 ([gene|618337D9BCD1586C5874746D1001DA3A2724E57C|yteJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCGCGTCCATTATTGTTC, downstream forward: _UP4_TAACCGATAACCCGGACTTC
  • BKK29520 ([gene|618337D9BCD1586C5874746D1001DA3A2724E57C|yteJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCGCGTCCATTATTGTTC, downstream forward: _UP4_TAACCGATAACCCGGACTTC
  • References

  • 9987136,12207695,31424929