SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ornithine transaminase
43.60 kDa
protein length
401 aa Sequence Blast
gene length
1203 bp Sequence Blast
arginine, ornithine and citrulline utilization
ornithine transaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • Gene

    4,144,301 → 4,145,506

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxocarboxylate + L-ornithine --> L-α-amino acid + L-glutamate 5-semialdehyde (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3RUY] (from ''B. anthracis'', 76% identity, 93% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [ Reference]
  • view in new tab

    Biological materials


  • GP656, aphA3, available in [SW|Jörg Stülke]'s lab
  • BKE40340 (Δ[gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAATTCCCCCTTG, downstream forward: _UP4_TAAATCCGCACCATGGCGGG
  • BKK40340 (Δ[gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGAATTCCCCCTTG, downstream forward: _UP4_TAAATCCGCACCATGGCGGG
  • References

  • 12618455,23869754,14651647,12618455,7540694