SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcription antitermination factor
14.74 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
stable RNA transcription
antitermination factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Transcription elongation/ termination]
  • Gene

    2,529,267 2,529,662

    The protein

    Protein family

  • nusB family (single member, according to UniProt)
  • Structure

  • [PDB|1EYV] (from Mycobacterium tuberculosis, 40% identity) [pubmed|10881194]
  • [PDB|3R2C] (the [protein|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|NusB]-[protein|751D0B909922D4D931FF3B2285CF142D966FCD48|RpsJ] complex from Aquifex aeolicus) [pubmed|21652641]
  • Expression and Regulation



    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750,11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|2536750,11591660]
  • view in new tab

    Biological materials


  • MGNA-C368 (yqhZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24320 ([gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCTCCTTTGAT, downstream forward: _UP4_TAGGAGGAAAGAAAATGACT
  • BKK24320 ([gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCTCCTTTGAT, downstream forward: _UP4_TAGGAGGAAAGAAAATGACT
  • References

  • 11948165,16707701,11591660,2536750,10881194,21652641,30023707