SubtiBank SubtiBank
sodA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sodA

superoxide dismutase, general stress protein, important for survival of ethanol and paraquat stresses and at low temperatures
locus
BSU25020
pI
5.20
mw
22.43 kDa
protein length
202 aa Sequence Blast
gene length
609 bp Sequence Blast
function
detoxification of oxygen radicals
product
superoxide dismutase
essential
no
ec
1.15.1.1
synonyms
yqgD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    2,585,434 2,586,042

    The protein

    Catalyzed reaction/ biological activity

  • 2 superoxide + 2 H+ = O2 + H2O2 (according to Swiss-Prot)
  • Protein family

  • iron/manganese superoxide dismutase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|E0645DD4A7A871457300139A7E5986EF11C07387|SodF]
  • Modification

  • phosphorylation on Thr-34 AND Thr-70 [Pubmed|17218307]
  • [SW|Cofactors]

  • manganese
  • Structure

  • [PDB|2RCV] [Pubmed|18084079]
  • [SW|Localization]

  • cytoplasm [Pubmed|22174384]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|913D6DA06785C3AD0C89D77D48831518C6663387|yqgC]-[gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • constitutive expression [Pubmed|22174384]
  • view in new tab

    Biological materials

    Mutant

  • GP3165 [gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::spec trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-C451 (yqgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2449 NBRP B. subtilis, Japan]
  • BKE25020 ([gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATTCCTCCTTAGT, downstream forward: _UP4_TAATGGCACAAACAAGGTCC
  • BKK25020 ([gene|6153A07B961017052E1072944B59F510D80CEC0F|sodA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATTCCTCCTTAGT, downstream forward: _UP4_TAATGGCACAAACAAGGTCC
  • References

  • 9393707,9573176,20525796,15805528,17218307,9658017,10074093,22174384,22582280,15378759,18084079