SubtiBank SubtiBank
yvzE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvzE

putative UTP-glucose-1-phosphate uridylyltransferase (UDP-glucose pyrophosphorylase) (UDPGP) (fragment)
locus
BSU_35699
pI
0.00
mw
0.00 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    3,672,929 3,673,525

    The protein

    Structure

  • [PDB|2UX8] (from Sphingomonas elodea, 47% identity) [pubmed|17434970]
  • Expression and Regulation

    Operons

    genes
    [gene|6129C1A4A1D917E22DE07EFBC284E416E0284E5E|yvzE]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE35699 ([gene|6129C1A4A1D917E22DE07EFBC284E416E0284E5E|yvzE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35699 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCAGAAGTGTTC, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • BKK35699 ([gene|6129C1A4A1D917E22DE07EFBC284E416E0284E5E|yvzE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35699 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTTCAGAAGTGTTC, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • References

  • 26577401,17434970