SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|sporulation] specific UV-damage-endonuclease
36.74 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
protection of developing and dormant spores against UV DNA damage

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,817,863 3,818,825

    The protein

    Protein family

  • uve1/UvsE family (single member, according to UniProt)
  • Structure

  • [PDB|3TC3] (from Sulfolobus acidocaldarius, 29% identity) [pubmed|23221644]
  • Expression and Regulation



    additional information

  • there is an antisense transcript for [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE] ([gene|22198D5928526CC964233355352D085D0A15DEE8|S1445]) [PubMed|22383849]
  • view in new tab

    Biological materials


  • MGNA-B660 (ywjD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37200 ([gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAACTCTCCTTTATA, downstream forward: _UP4_TAAATGTGCAAAAATAGGTT
  • BKK37200 ([gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAACTCTCCTTTATA, downstream forward: _UP4_TAAATGTGCAAAAATAGGTT
  • References

  • 22383849,22961846,23221644,30096406