SubtiBank SubtiBank
ywjD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywjD

[SW|sporulation] specific UV-damage-endonuclease
locus
BSU_37200
pI
8.99
mw
36.74 kDa
protein length
320 aa Sequence Blast
gene length
963 bp Sequence Blast
function
protection of developing and dormant spores against UV DNA damage
product
UV-damage-endonuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,817,863 3,818,825

    The protein

    Protein family

  • uve1/UvsE family (single member, according to UniProt)
  • Structure

  • [PDB|3TC3] (from Sulfolobus acidocaldarius, 29% identity) [pubmed|23221644]
  • Expression and Regulation

    Operons

    genes
    [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE]-[gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]
    description
    [Pubmed|22383849]

    additional information

  • there is an antisense transcript for [gene|B63AAF0D3277FD776944A09D2546F3E48C8716AD|ywjE] ([gene|22198D5928526CC964233355352D085D0A15DEE8|S1445]) [PubMed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B660 (ywjD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1659 NBRP B. subtilis, Japan]
  • BKE37200 ([gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAACTCTCCTTTATA, downstream forward: _UP4_TAAATGTGCAAAAATAGGTT
  • BKK37200 ([gene|611B441B84C2179B7A19745461CA1725DF2F82CD|ywjD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGGAACTCTCCTTTATA, downstream forward: _UP4_TAAATGTGCAAAAATAGGTT
  • References

  • 22383849,22961846,23221644,30096406