SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


protein tyrosine kinase
25.64 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
protein phosphorylation
protein tyrosine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,731,822 3,732,535

    Phenotypes of a mutant

  • Accumulation of extra chromosome equivalents [Pubmed|17367396]
  • Defect in [SW|biofilm formation], this involves the kinase activity, but the target protein is unknown [Pubmed|20815827]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
  • autophosphorylation, phosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB], [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB]
  • Protein family

  • BY-kinase, see the [ Bacterial Protein Tyrosine Kinase Database]
  • CpsD/CapB family (with [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB]
  • [SW|Domains]

  • single BY-kinase domain
  • Modification

  • autophosphorylation at residues Y225, Y227 and Y228 (primary site) [Pubmed|20509597], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|15866923]
  • [SW|Cofactors]

  • ATP
  • Effectors of protein activity

  • [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA] - transmembrane modulator, activates PtkA autophosphorylation and substrate phosphorylation [Pubmed|12970183]
  • the mutually exclusive interactions of PtsA with the modulator proteins [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], [protein|8841E35B7A90F6716C0BCD98E8D0CC05FE1CA471|SalA], and probably [protein|37DAD42A391E2FC506225EAF91B8F21629A401DF|MinD] direct the kinase to different substrates [Pubmed|27725816]
  • Structure

  • [PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'')
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A078 (ywqD::erm), available at the [ NBRP B. subtilis, Japan]
  • KO strain created with pMUTIN-2, available from [SW|Ivan Mijakovic]
  • GP1520 (spc), available in [SW|Jörg Stülke]'s lab
  • GP1544 (ermC), available in [SW|Jörg Stülke]'s lab
  • GP1587 (cat) , available in [SW|Jörg Stülke]'s lab
  • GP1521 ''[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'' (aphA3) ''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]'' (spc) double mutant available in [SW|Jörg Stülke]'s lab
  • GP1529 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]''::spc available in [SW|Jörg Stülke]'s lab
  • GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [SW|Jörg Stülke]'s lab
  • BKE36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCC
  • BKK36250 ([gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCATCCGCGAGCCTCTGT, downstream forward: _UP4_TAAATAACGTGCATCGTGCC
  • Expression vectors

  • pQE-30, N-terminally 6xHis-tagged, available from [SW|Ivan Mijakovic]
  • lacZ fusion

  • in a KO strain created with pMUTIN-2, available from [SW|Ivan Mijakovic]
  • GFP fusion

  • CFP-fusion, available from [SW|Ivan Mijakovic]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Ivan Mijakovic], Thiverval-Grignon, France
  • References


  • 20497498,24554699,25540643,25667587,26286503
  • Original publications

  • 12970183,15741737,15866923,17367396,19258708,18547145,20497499,20509597,20815827,20817675,23939619,24493247,24728941,25278935,25374563,26283769,26094643,27148221,27725816