SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation protein
25.45 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
sporulation protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,714,002 3,714,679

    The protein


  • phosphorylated on Ser-208 [Pubmed|20509597]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8755863,1691789,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15470121], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|26577401,15699190,8755863,15470121]
  • view in new tab



  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [protein|search|GerR]) [Pubmed|15699190,1691789,15383836,20435725]
  • view in new tab

    Biological materials


  • MGNA-A572 (ywrJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36040 ([gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTCTCCTCCTTTAAC, downstream forward: _UP4_TAGTGTATACAAAACTGCCC
  • BKK36040 ([gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTCTCCTCCTTTAAC, downstream forward: _UP4_TAGTGTATACAAAACTGCCC
  • References

  • 9353933,15699190,12480901,20509597