SubtiBank SubtiBank
ywrJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywrJ

sporulation protein
locus
BSU36040
pI
5.96
mw
25.45 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,714,002 3,714,679

    The protein

    Modification

  • phosphorylated on Ser-208 [Pubmed|20509597]
  • Expression and Regulation

    Operons

    genes
    [gene|D53067098F693669F61E5CCF6C06664580C40C79|cotH]-[gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]-[gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8755863,1691789,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15470121], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|26577401,15699190,8755863,15470121]
  • view in new tab

    genes
    [gene|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|cotB]-[gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]
    description
    [Pubmed|22383849]

    regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [protein|search|GerR]) [Pubmed|15699190,1691789,15383836,20435725]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A572 (ywrJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/572 NBRP B. subtilis, Japan]
  • BKE36040 ([gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTCTCCTCCTTTAAC, downstream forward: _UP4_TAGTGTATACAAAACTGCCC
  • BKK36040 ([gene|61004D2C1EDA3CD84514FD6D468BF594575616F4|ywrJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGATTCTCCTCCTTTAAC, downstream forward: _UP4_TAGTGTATACAAAACTGCCC
  • References

  • 9353933,15699190,12480901,20509597