SubtiBank SubtiBank
ybzI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybzI

unknown
locus
BSU_02019
pI
8.93
mw
8.80 kDa
protein length
gene length
264 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    222,971 223,234

    Biological materials

    Mutant

  • BKE02019 ([gene|60F5D605E6775AEEB22C4CDBA0234CF193A652AC|ybzI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02019 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCATTTCTTTCTCCCT, downstream forward: _UP4_CCGCTTTTGGGACAAGGGTT
  • BKK02019 ([gene|60F5D605E6775AEEB22C4CDBA0234CF193A652AC|ybzI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02019 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCATTTCTTTCTCCCT, downstream forward: _UP4_CCGCTTTTGGGACAAGGGTT