SubtiBank SubtiBank
ycbL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycbL

two-component response regulator ([SW|OmpR family])
locus
BSU_02550
pI
4.92
mw
25.66 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    278,377 279,057

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 1-112) (according to UniProt)
  • Modification

  • phosphorylation by [protein|348F81B6ECB6FFBEC092A672FF5F40FE86918872|YcbM] ( on an aspartate residue, putative)
  • Effectors of protein activity

  • activity is controlled by [protein|348F81B6ECB6FFBEC092A672FF5F40FE86918872|YcbM]-dependent phosphorylation (putative)
  • Structure

  • [PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 38% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]-[gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]-[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]-[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C034 (ycbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2032 NBRP B. subtilis, Japan]
  • BKE02550 ([gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGCGCTGCATCTCCT, downstream forward: _UP4_GGTTATAAATTAGGAGAGTT
  • BKK02550 ([gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATGCGCTGCATCTCCT, downstream forward: _UP4_GGTTATAAATTAGGAGAGTT
  • References

  • 10094672,23504016,17942407