SubtiBank SubtiBank
comX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

comX

competence pheromone precursor, transfers cell density signal to [protein|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|ComP]; triggers the production of surfactin
locus
BSU_31700
pI
4.36
mw
6.38 kDa
protein length
gene length
168 bp Sequence Blast
function
[category|SW 3.4.8|Quorum sensing]
product
competence pheromone precursor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    3,255,853 3,256,020

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Modification

  • is synthesized as an inactive precursor, cleaved, and modified (prenylated) on W53 by [protein|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|ComQ] prior to excretion [Pubmed|28326143,22878193]
  • ComX is degraded by [protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|subtilisin] [pubmed|29449835]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]-[gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]-[gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE31700 ([gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • BKK31700 ([gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATTAGGTCTTGCATCTTGT, downstream forward: _UP4_GGTGATTAATAGGTGGATTA
  • References

    Reviews

  • 22024380,28326143,30218468
  • Original publications

  • 16407988,11133937,12067344,19202088,14679219,15564679,17240141,19605685,1715859,22878193,24296669,22511326,21636272,24425772,24788106,25757097,26276536,26787913,26927849,29038467,29449835,32727033