SubtiBank SubtiBank
ydzT/2
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzT/2

putative integrase (fragment), internal part of YdzT
locus
BSU_06034
pI
0.00
mw
0.00 kDa
protein length
gene length
159 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    652,087 652,245

    Biological materials

    Mutant

  • BKE06034 ([gene|60C6A5E55F38F4EB2B118F3A3492A459A4C6CFD0|ydzT/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06034 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTTTAAGCTTAA, downstream forward: _UP4_ATACCCATACCTCCTTACTA
  • BKK06034 ([gene|60C6A5E55F38F4EB2B118F3A3492A459A4C6CFD0|ydzT/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06034 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCTATTTTTAAGCTTAA, downstream forward: _UP4_ATACCCATACCTCCTTACTA