SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


antimutator protein, has RNA pyrophosphohydrolase activity
16.26 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
DNA repair, protection against oxidative stress
antimutator protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    488,314 488,763

    The protein

    Catalyzed reaction/ biological activity

  • 8-oxo-dGTP + H2O --> 8-oxo-dGMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 1-123) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31740579]
  • Structure

  • [PDB|1VC8] (N-terminal 100 amino acids of Ap6A hydrolase from Thermus thermophilus, 40% identity)
  • Biological materials


  • MGNA-C093 (mutT::erm), available at the [ NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • BKK04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • References

  • 16513759,31740579