SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


antimutator protein, has RNA pyrophosphohydrolase activity
16.26 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
DNA repair, protection against oxidative stress
antimutator protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    488,314 488,763

    The protein

    Catalyzed reaction/ biological activity

  • 8-oxo-dGTP + H2O --> 8-oxo-dGMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 1-123) (according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|31740579]
  • Structure

  • [PDB|1VC8] (N-terminal 100 amino acids of Ap6A hydrolase from Thermus thermophilus, 40% identity)
  • Biological materials


  • MGNA-C093 (mutT::erm), available at the [ NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • BKK04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • References

  • 16513759,31740579