SubtiBank SubtiBank
mutT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mutT

antimutator protein
locus
BSU_04330
pI
8.59
mw
16.26 kDa
protein length
149 aa Sequence Blast
gene length
450 bp Sequence Blast
function
DNA repair, protection against oxidative stress
product
antimutator protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    488,314 488,763

    The protein

    Catalyzed reaction/ biological activity

  • 8-oxo-dGTP + H2O --> 8-oxo-dGMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 1-123) (according to UniProt)
  • Structure

  • [PDB|1VC8] (N-terminal 100 amino acids of Ap6A hydrolase from Thermus thermophilus, 40% identity)
  • Biological materials

    Mutant

  • MGNA-C093 (mutT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2091 NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • BKK04330 ([gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCCCATACCTCCTTTTC, downstream forward: _UP4_TGATTCAGGTCTCCGGGTTT
  • References

  • 16513759