SubtiBank SubtiBank
yjcK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcK

similar to ribosomal-protein-alanine N-acetyltransferase
locus
BSU_11890
pI
5.46
mw
20.78 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.3.1.128
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.6|Protein acetylase/ deacetylase/ based on similarity]
  • Gene

    Coordinates
    1,260,811 1,261,356

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + N-terminal L-alanyl-[ribosomal protein uS5] --> CoA + H+ + N-terminal Nα-acetyl-L-alanyl-[ribosomal protein uS5] (according to UniProt)
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|YdaF]
  • [protein|F92B7EC7A00BF295666D68613932D239F92C7347|YkkB]:
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 7-172) (according to UniProt)
  • Structure

  • [PDB|3IGR] (from Vibrio fischeri, 35% identity)
  • [SW|Localization]

  • cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|470824F73C8C9CF0519C1E536DBF19D8A93723CE|yjcL]-[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B257 (yjcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1256 NBRP B. subtilis, Japan]
  • GP1246 (''yjcK''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP1255 (''[gene|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|acuA]''::''kan'' ''[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''cat'' ''[gene|18FA5EFCD78C74296F9E52A64DA4A9D635944528|ynaD]''::''spec'' ''[gene|4A8360E50ADBA4CC859A64A72EBC0A07F70A1764|yoaA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BP139 (''[gene|470824F73C8C9CF0519C1E536DBF19D8A93723CE|yjcL]-[gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]''::''ermC''), available in [SW|Fabian Commichau]'s lab
  • BKE11890 ([gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGATCTCTCCGTT, downstream forward: _UP4_TAATAAAAGAAGCCGGACTA
  • BKK11890 ([gene|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|yjcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGTGATCTCTCCGTT, downstream forward: _UP4_TAATAAAAGAAGCCGGACTA
  • References

  • 16479537,22383849