SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


required for proper septum positioning during vegetative growth ([SW|cell shape] determination), part of the [protein|search|Rod complex] for lateral [SW|cell wall synthesis] and control of cell diameter
23.48 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
septum positioning during vegetative growth
morphogenic protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,761,707 1,762,573

    Phenotypes of a mutant

  • essential [Pubmed|19164570,23879732]
  • depletion results in the formation of shorter and rounder cells [Pubmed|23879732]
  • depletion results in disturbed formation of asymmetric septa and perturbed [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation [Pubmed|27415800]
  • hypersensitivity to sorbic acid stress [Pubmed|27818647]
  • small, round, DNA-containing cells [pubmed|29403445]
  • The protein


  • N-terminal cytoplasmic domain (RodZn), a transmembrane domain, and C-terminal extra-cytoplasmic domain (RodZc) [Pubmed|25503291]
  • Structure

  • [PDB|3FYM] (from Staphylococcus aureus, corresponds to aa 1 ... 112, 31% identity)
  • [SW|Localization]

  • membrane protein (according to UniProt)
  • Additional information

  • overexpression results in growth inhibition in minimal medium (in the absence of Mg2+ ) [Pubmed|19164570]
  • RodZ is destabilized in a ''[gene|A4C8719E06F774A6EB4D79757CC79CF89E453A54|mreB]'' mutant [Pubmed|23879732]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B120 (ymfM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16910 ([gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • BKK16910 ([gene|6071A84EF190C820DB8985C08ABC74F744B793DB|rodZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCTCTCTGG, downstream forward: _UP4_TAATTACCAGATGACTTTTC
  • labs

  • [SW|Adriano Henriques], Lisbon, Portugal [ homepage]
  • References

  • 19164570,21636744,21636745,23879732,25503291,27415800,27818647,29403445,30651563,31086310