SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


pectate lyase C
45.34 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
degradation of polygalacturonic acid
pectate lyase C

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    827,993 829,255

    The protein

    Catalyzed reaction/ biological activity

  • Eliminative cleavage of (14)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|2O1D] (bound to trisaccharide), [PDB|1BN8], [PDB|5X2I]
  • [SW|Localization]

  • extracellular (signal peptide), major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials


  • MGNA-C248 (pel::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07560 ([gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCACTATGTACCCCCAT, downstream forward: _UP4_TAAGAAAGTGAAAAACACAA
  • BKK07560 ([gene|60595234B02D673E860B364FE8A3C83D2CC68CB2|pel]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCACTATGTACCCCCAT, downstream forward: _UP4_TAAGAAAGTGAAAAACACAA
  • References


  • 20735481
  • Original publications

  • 8262178,16091051,12823818,18957862,12850135,25755103,7634076,26582911,27447541,27965289