SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


30.35 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    689,146 690,342

    The protein


  • phosphorylated on Arg-250 [pubmed|31221751]
  • Biological materials


  • MGNA-A916 (yeaD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06340 ([gene|60445E01C58A2036EDAE7919D18BEFCB1CF5DE42|yeaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGGACCGCCGACCT, downstream forward: _UP4_TAGAAAGAGAGGTGACTGGT
  • BKK06340 ([gene|60445E01C58A2036EDAE7919D18BEFCB1CF5DE42|yeaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGGACCGCCGACCT, downstream forward: _UP4_TAGAAAGAGAGGTGACTGGT
  • References

    Research papers

  • 31221751