SubtiBank SubtiBank
yeaD

yeaD

unknown
locus
BSU_06340
pI
8.74
mw
30.35 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    689,146 690,342

    The protein

    Modification

  • phosphorylated on Arg-250 [pubmed|31221751]
  • Biological materials

    Mutant

  • MGNA-A916 (yeaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/916 NBRP B. subtilis, Japan]
  • BKE06340 ([gene|60445E01C58A2036EDAE7919D18BEFCB1CF5DE42|yeaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGGACCGCCGACCT, downstream forward: _UP4_TAGAAAGAGAGGTGACTGGT
  • BKK06340 ([gene|60445E01C58A2036EDAE7919D18BEFCB1CF5DE42|yeaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCGGACCGCCGACCT, downstream forward: _UP4_TAGAAAGAGAGGTGACTGGT
  • References

    Research papers

  • 31221751