SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


peptidoglycan deacetylase C, confers lysozyme resistance to modified cell wall peptidoglycans
53.67 kDa
protein length
467 aa Sequence Blast
gene length
1404 bp Sequence Blast
cell wall modification
polysaccharide deacetylase C

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,281,128 1,282,531

    Phenotypes of a mutant

  • sensitive to lysozyme treatment [Pubmed|22277649]
  • The protein

    Catalyzed reaction/ biological activity

  • deacetylates N-acetylmuramic acid (MurNAc) but not GlcNAc from peptidoglycan [Pubmed|22277649]
  • Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|YheN]:
  • [SW|Domains]

  • aa 55 - 140: DUF4163
  • aa 155 - 235: DUF3298
  • [SW|NodB homology domain] (aa 278-452) (according to UniProt)
  • Structure

  • [PDB|6H8L] (the C-terminal family 4 carbohydrate esterase (CE4) catalytic domain) [pubmed|31690626]
  • [PDB|2C1G] (the NodB domain, from Streptococcus pneumoniae, 47% identity) [pubmed|16221761]
  • [PDB|3S5T] (the DUF3298 domain, from Bacteroides fragilis, 27% identity)
  • [SW|Localization]

  • cell membrane (single pass) [pubmed|31690626]
  • Expression and Regulation



    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-A355 (yjeA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12100 ([gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC
  • BKK12100 ([gene|603E226CE488A25C4E28A6A7363CCD65BE64BB21|pdaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACAAAAACTCCTTCTTTC, downstream forward: _UP4_TAAATTAGAAAAGGCTGTCC
  • References

  • 17878218,17581128,22277649,23199363,26883633,16221761,29465029,31690626