SubtiBank SubtiBank
tagC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tagC

possibly involved in polyglycerol phosphate teichoic acid biosynthesis
locus
BSU_35770
pI
7.34
mw
50.66 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
biosynthesis of teichoic acid
product
unknown
essential
no
synonyms
dinC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • Gene

    Coordinates
    3,683,438 3,684,766

    The protein

    Structure

  • [PDB|5EFV] (from Staphylococcus aureus phage, corresponds to aa 14 ... 286, 32% identity) [pubmed|27282779]
  • [SW|Localization]

  • cytoplasm (homogenous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC]
    description
    [Pubmed|7934877]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [PubMed|8226626,8969214], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8226626,8969214 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE35770 ([gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTTACCACCTCTAT, downstream forward: _UP4_TGATAATCAAATAGGCTGTA
  • BKK35770 ([gene|60344F56DEB167FA62C16E52E8238393CEE19312|tagC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAATTTACCACCTCTAT, downstream forward: _UP4_TGATAATCAAATAGGCTGTA
  • References

  • 8226626,8969214,9555905,7934877,16267290,16479537,27282779