SubtiBank SubtiBank
mmgE [2018-01-03 10:33:55]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mmgE [2018-01-03 10:33:55]

2-methylcitrate dehydratase
52.74 kDa
protein length
472 aa Sequence Blast
gene length
1416 bp Sequence Blast
mother cell metabolism
2-methylcitrate dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,508,221 → 2,509,639

    The protein

    Catalyzed reaction/ biological activity

  • 2-methylcitrate --> 2-methylaconitate [pubmed|28956599]
  • Protein family

  • prpD family (according to Swiss-Prot)
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|1SZQ] (from E. coli, 60% identity)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials


  • BKE24130 (Δ[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • BKK24130 (Δ[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • References

  • 8759838,15699190,28956599