SubtiBank SubtiBank
mmgE [2017-09-29 12:11:07]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mmgE [2017-09-29 12:11:07]

putative methyl-cis-aconitase
locus
BSU24130
pI
6.11
mw
52.74 kDa
protein length
472 aa Sequence Blast
gene length
1416 bp Sequence Blast
function
mother cell metabolism
product
unknown
essential
no
ec
4.2.1.79
synonyms
yqiP,prpD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,508,221 → 2,509,639

    The protein

    Catalyzed reaction/ biological activity

  • (2S,3S)-2-hydroxybutane-1,2,3-tricarboxylate = (Z)-but-2-ene-1,2,3-tricarboxylate + H2O (according to Swiss-Prot)
  • Protein family

  • prpD family (according to Swiss-Prot)
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|1SZQ] (from E. coli, 60% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24130 (Δ[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • BKK24130 (Δ[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • References

  • 8759838,15699190