SubtiBank SubtiBank
mmgE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mmgE

2-methylcitrate dehydratase
locus
BSU_24130
pI
6.11
mw
52.74 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
function
mother cell metabolism
product
2-methylcitrate dehydratase
essential
no
ec
4.2.1.79
synonyms
yqiP,prpD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,508,221 2,509,639

    The protein

    Catalyzed reaction/ biological activity

  • 2-methylcitrate --> 2-methylaconitate [pubmed|28956599]
  • citrate --> cis-aconitate + H2O (according to UniProt)
  • Protein family

  • prpD family (with [protein|7DDB283173267AA106DC277787AAAB4F4F9975F4|YxeQ], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|5MUX]
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24130 ([gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • BKK24130 ([gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCGGCATTCTACCAGCTC, downstream forward: _UP4_ATGTAAAAGGGGGATTTTGT
  • References

  • 8759838,15699190,28956599