SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


nutrient receptor, [SW|germination] response to L-alanine, triggers premature [SW|germination] in response to morphological defects during [SW|sporulation]
41.30 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
germination response to L-alanine
nutrient receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,392,199 3,393,296

    Phenotypes of a mutant

  • suppresses the defects of [gene|40BCEB3648585961D22B71BBB4FB62EE4B3E360D|spoVV] mutant spores [pubmed|28605069]
  • The protein

    Catalyzed reaction/ biological activity

  • triggers premature [SW|germination] in response to morphological defects during [SW|sporulation] [pubmed|28605069]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE], [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB], [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|GerBB]
  • [SW|Localization]

  • predicted to be an integral membrane protein with ten membrane-spanning helices [Pubmed|21378181]
  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325,15699190,8755877]
  • additional information

  • 1,100 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials


  • BKE33060 ([gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACAATAGAAATACCTTGAA, downstream forward: _UP4_CTCAAGAGGAGGATTACAAC
  • BKK33060 ([gene|5FF739B8C087207039BB6DC293EE77F59337ED0B|gerAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACAATAGAAATACCTTGAA, downstream forward: _UP4_CTCAAGAGGAGGATTACAAC
  • References


  • 27337279
  • Original publications

  • 3110007,17573930,12670969,2110996,15774895,16497325,16352818,8755877,21378181,21378197,21696470,22327596,23396907,24916603,22343299,16740944,26731423,28605069