SubtiBank SubtiBank
ykkC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykkC

putative guanidine exporter
locus
BSU_13090
pI
5.36
mw
11.78 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
export/ detoxification of guanidine
product
subunit of guanidine exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,376,517 1,376,855

    The protein

    Protein family

  • paired small multidrug resistance protein family ([SW|PSMR family]) [Pubmed|17942072]
  • [SW|drug/metabolite transporter (DMT) superfamily] (according to UniProt)
  • [SW|Small multidrug resistance (SMR) (TC 2.A.7.1) family] (according to UniProt)
  • Structure

  • [PDB|5U3G] (the [SW|riboswitch] from Dickeya dadantii, bound to guanidinium) [pubmed|28096518]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]-[gene|5001019AD87FEF7D7A920D570C1053D476F7F20C|ykkD]
    description
    [Pubmed|10735877]

    regulatory mechanism

  • [protein|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch]: antitermination, [pubmed|28060483,27989440], in [regulon|E9866855F0156859C45E98F3B385FE1263BB7EBC|YkkC riboswitch regulon]
  • regulation

  • induced in the presence of guanidine ([SW|ykkC riboswitch]) [Pubmed|27989440]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A747 (ykkC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/747 NBRP B. subtilis, Japan]
  • BKE13090 ([gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAGTCATTCCTTTC, downstream forward: _UP4_GAGGAAAAAGGAGGCGAGGC
  • BKK13090 ([gene|5FD89F65E481CDC33B10A58C12C3168B929917ED|ykkC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAGTCATTCCTTTC, downstream forward: _UP4_GAGGAAAAAGGAGGCGAGGC
  • References

    Reviews

  • 17942072,28060483
  • Original publications

  • 15096624,10735877,21317561,27120414,27989440,28096518