SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


tRNA specific adenosine deaminase
17.61 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
tRNA modification
tRNA specific adenosine deaminase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    25,852 26,337

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the deamination of adenosine to inosine at the wobble position 34 of tRNA(Arg2) (according to UniProt)
  • adenosine34 in tRNA + H+ + H2O --> inosine34 in tRNA + NH4+ (according to UniProt)
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 2-120) (according to UniProt)
  • Structure

  • [PDB|2B3J] (the protein of ''Staphylococcus aureus'', complex with RNA) [Pubmed|16415880]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, (both promoters), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B891 (yaaJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • BKK00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • References

  • 19087206,12110595,16415880,28864459