SubtiBank SubtiBank
yaaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yaaJ

tRNA specific adenosine deaminase
locus
BSU_00180
pI
5.64
mw
17.61 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
tRNA modification
product
tRNA specific adenosine deaminase
essential
no
synonyms
tadA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    25,852 26,337

    The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the deamination of adenosine to inosine at the wobble position 34 of tRNA(Arg2) (according to UniProt)
  • adenosine34 in tRNA + H+ + H2O --> inosine34 in tRNA + NH4+ (according to UniProt)
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 2-120) (according to UniProt)
  • Structure

  • [PDB|2B3J] (the protein of ''Staphylococcus aureus'', complex with RNA) [Pubmed|16415880]
  • Expression and Regulation

    Operons

    genes
    [gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]-[gene|097C817A5A3E31F73F6ABC4AA95852A64E43A057|scr]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, (both promoters), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B891 (yaaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1890 NBRP B. subtilis, Japan]
  • BKE00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • BKK00180 ([gene|5FC8D0B30B55C1CBC2CDE8E56E7E948A781EF2AB|yaaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGGATAAGCTCTCTTT, downstream forward: _UP4_TAGTACGGTTGCAATTTTTA
  • References

  • 19087206,12110595,16415880,28864459