SubtiBank SubtiBank
yrkF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrkF

putative sulfur carrier protein
locus
BSU26530
pI
5.99
mw
20.51 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,712,577 2,713,134

    The protein

    Protein family

  • sulfur carrier protein TusA family (according to Swiss-Prot) (with [protein|D996F581E21395C3F9CC064800C49A765EFC17A7|YrkI])
  • Structure

  • [PDB|1DCJ] (E. coli TusA, corresponds to the N-terminal domain of [protein|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|YrkF], aa 8 ... 77, 37% identity)
  • [PDB|3R2U] (metallo--lactamase from Staphylococcus aureus, corresponds to the C-terminal domain of [protein|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|YrkF], aa 106 ... 179, 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]-[gene|8A3F1BFDF85DD96B7FB4EBC807F71639AF69DE98|yrkD]-[gene|1F1FE531622CD218EE8990CDAC6D2D2F9E86FE3F|yrkE]-[gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]-[gene|06CC915A18E5ADD42B784B7BBBFD4C344559A34E|yrkH]-[gene|D996F581E21395C3F9CC064800C49A765EFC17A7|yrkI]-[gene|F3E842844B315FE438F66995CDFB8BA1C32BDF23|yrkJ]-[gene|1BEBD09273240B6B50DABCB160FCCBC205BB2AAE|yrkK]-[gene|search|yrkM]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|6AD1DD074B2F044C6A4E4B98FABC4E7FD67B3139|yrzM]-[gene|8A3F1BFDF85DD96B7FB4EBC807F71639AF69DE98|yrkD]-[gene|1F1FE531622CD218EE8990CDAC6D2D2F9E86FE3F|yrkE]-[gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]-[gene|06CC915A18E5ADD42B784B7BBBFD4C344559A34E|yrkH]-[gene|D996F581E21395C3F9CC064800C49A765EFC17A7|yrkI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26530 ([gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTTTTCTT, downstream forward: _UP4_TAAATAAAAAGCATGATGAA
  • BKK26530 ([gene|5FC3DF596816AA4E8541B324EC6DE6D89C90C8E2|yrkF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTTTTCTT, downstream forward: _UP4_TAAATAAAAAGCATGATGAA