SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inner spore coat protein
11.58 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
protection of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class IV]
  • Gene

    2,897,788 2,898,123

    The protein


  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814,19933362]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,15383836,12480901]
  • view in new tab

    Biological materials


  • MGNA-A993 (ysnD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28320 ([gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCTTTTCTTT, downstream forward: _UP4_TAAAGAATACCACAAGGGCC
  • BKK28320 ([gene|5FA26477DF2CE415AB20319853FCB77ABAC71316|ysnD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTATCACCTTTTCTTT, downstream forward: _UP4_TAAAGAATACCACAAGGGCC
  • References

  • 19933362,15699190,15383836,12480901,22171814,25755103