SubtiBank SubtiBank
queF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

queF

nitrile reductase (NADPH-dependent 7-cyano-7-deazaguanine reductase), synthesis of the modified ribonucleotide queuosine
locus
BSU_13750
pI
4.93
mw
19.23 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
tRNA modification
product
nitrile reductase
essential
no
ec
1.7.1.13
synonyms
ykvM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,441,291 1,441,788

    The protein

    Catalyzed reaction/ biological activity

  • 7-aminomethyl-7-carbaguanine + 2 NADP+ --> 7-cyano-7-deazaguanine + 3 H+ + 2 NADPH (according to UniProt)
  • Protein family

  • GTP cyclohydrolase I family (with [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE], according to UniProt)
  • Modification

  • active site Cys55 is S-bacillithiolated by NaOCl stress [Pubmed|22938038]
  • disulfide formation between the catalytic Cys55 and conserved Cys99 protects the protein from irreversible oxidation [pubmed|28300774]
  • [SW|Cofactors]

  • NADPH [pubmed|28300774]
  • Structure

  • [PDB|4F8B] (covalent thioimide intermediate of the unimodular nitrile reductase [protein|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|QueF]) [Pubmed|22787148]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]-[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]-[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]-[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]
    description
    [Pubmed|14660578]

    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B326 (ykvM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1325 NBRP B. subtilis, Japan]
  • BKE13750 ([gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATGTTCATCTTCCTTT, downstream forward: _UP4_TAATTATTCCGTTGTGTGAT
  • BKK13750 ([gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATGTTCATCTTCCTTT, downstream forward: _UP4_TAATTATTCCGTTGTGTGAT
  • References

  • 22938038,14660578,15767583,16511203,17929836,19285444,17384645,22787148,28300774,28516784