SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


nitrile reductase (NADPH-dependent 7-cyano-7-deazaguanine reductase), synthesis of the modified ribonucleotide queuosine
19.23 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
tRNA modification
nitrile reductase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    1,441,291 1,441,788

    The protein

    Catalyzed reaction/ biological activity

  • 7-aminomethyl-7-carbaguanine + 2 NADP+ --> 7-cyano-7-deazaguanine + 3 H+ + 2 NADPH (according to UniProt)
  • Protein family

  • GTP cyclohydrolase I family (with [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE], according to UniProt)
  • Modification

  • active site Cys55 is S-bacillithiolated by NaOCl stress [Pubmed|22938038]
  • disulfide formation between the catalytic Cys55 and conserved Cys99 protects the protein from irreversible oxidation [pubmed|28300774]
  • [SW|Cofactors]

  • NADPH [pubmed|28300774]
  • Structure

  • [PDB|4F8B] (covalent thioimide intermediate of the unimodular nitrile reductase [protein|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|QueF]) [Pubmed|22787148]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials


  • MGNA-B326 (ykvM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13750 ([gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATGTTCATCTTCCTTT, downstream forward: _UP4_TAATTATTCCGTTGTGTGAT
  • BKK13750 ([gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATGTTCATCTTCCTTT, downstream forward: _UP4_TAATTATTCCGTTGTGTGAT
  • References

  • 22938038,14660578,15767583,16511203,17929836,19285444,17384645,22787148,28300774,28516784