SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator ([SW|OmpR family])
26.03 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    221,258 221,929

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylated by [protein|EA36C28A990EFFAEBFE279467A0B56B6B5F5255D|YbdK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|1KGS](from Thermotoga maritima, 32% identity) [pubmed|11839301]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • MGNA-B956 (ybdJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02000 ([gene|5F6D14A0B360832F9FD470668B006A628B109A56|ybdJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATACGATAACCCT, downstream forward: _UP4_TGAAGCTCAAGACAAAATAT
  • BKK02000 ([gene|5F6D14A0B360832F9FD470668B006A628B109A56|ybdJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTAAAATACGATAACCCT, downstream forward: _UP4_TGAAGCTCAAGACAAAATAT
  • References

  • 10094672,23504016,11839301