SubtiBank SubtiBank
yvdK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvdK

maltose phosphorylase
locus
BSU_34570
pI
5.15
mw
88.09 kDa
protein length
757 aa Sequence Blast
gene length
2274 bp Sequence Blast
function
utilization of maltose
product
maltose phosphorylase
essential
no
synonyms
malK,mdxK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.22|Utilization of maltose]
  • Gene

    Coordinates
    3,549,228 3,551,501

    The protein

    Catalyzed reaction/ biological activity

  • D-maltose + phosphate --> β-D-glucose 1-phosphate + D-glucose (according to UniProt)
  • Protein family

  • glycosyl hydrolase 65 family (single member, according to UniProt)
  • Structure

  • [PDB|1H54] (from Lactobacillus brevis, 56% identity) [pubmed|11587643]
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B623 (yvdK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1622 NBRP B. subtilis, Japan]
  • BKE34570 ([gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTGATTTTCCATTCAT, downstream forward: _UP4_GGACGATGTGAAAGGAGAAC
  • BKK34570 ([gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTGATTTTCCATTCAT, downstream forward: _UP4_GGACGATGTGAAAGGAGAAC
  • References

  • 16707683,11587643