SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


maltose phosphorylase
88.09 kDa
protein length
757 aa Sequence Blast
gene length
2274 bp Sequence Blast
utilization of maltose
maltose phosphorylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of maltose]
  • Gene

    3,549,228 3,551,501

    The protein

    Protein family

  • glycosyl hydrolase 65 family (according to Swiss-Prot)
  • Structure

  • [PDB|1H54] (from Lactobacillus brevis, 56% identity) [pubmed|11587643]
  • Expression and Regulation




  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials


  • MGNA-B623 (yvdK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34570 ([gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTGATTTTCCATTCAT, downstream forward: _UP4_GGACGATGTGAAAGGAGAAC
  • BKK34570 ([gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTGATTTTCCATTCAT, downstream forward: _UP4_GGACGATGTGAAAGGAGAAC
  • References

  • 16707683,11587643