SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of the iol operon, [SW|DeoR family]
28.25 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
regulation of myo-inositol catabolism
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,084,799 4,085,554

    Phenotypes of a mutant

  • inactivation of ''[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]'' reduces sporulation efficiency to 38% that of wild type cells [Pubmed|26735940]
  • The protein


  • [SW|HTH deoR-type domain] (aa 1-57) (according to UniProt)
  • Effectors of protein activity

  • inducer: 2-deoxy-5-keto-D-gluconic acid-6-phosphate
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
  • view in new tab

    Biological materials


  • BKE39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • BKK39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 18310071,9226270,9887260,9887260,18310071,26735940