SubtiBank SubtiBank
iolR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

iolR

transcriptional repressor of the iol operon, [SW|DeoR family]
locus
BSU_39770
pI
6.33
mw
28.25 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
regulation of myo-inositol catabolism
product
transcriptional repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    4,084,799 4,085,554

    Phenotypes of a mutant

  • inactivation of ''[gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]'' reduces sporulation efficiency to 38% that of wild type cells [Pubmed|26735940]
  • The protein

    [SW|Domains]

  • [SW|HTH deoR-type domain] (aa 1-57) (according to UniProt)
  • Effectors of protein activity

  • inducer: 2-deoxy-5-keto-D-gluconic acid-6-phosphate
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000051 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]-[gene|F1AFFACD36C75702B0BB8F0B4241A9688FB6253C|iolS]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9226270]
  • view in new tab

    Biological materials

    Mutant

  • BKE39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • BKK39770 ([gene|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|iolR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 18310071,9226270,9887260,9887260,18310071,26735940