SubtiBank SubtiBank
rpoY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpoY

epsilon subunit of [SW|RNA polymerase]
locus
BSU_14540
pI
4.61
mw
8.12 kDa
protein length
gene length
210 bp Sequence Blast
function
control of [SW|RNA polymerase] activity
product
epsilon subunit of [SW|RNA polymerase]
essential
no
synonyms
ykzG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.1|RNA polymerase]
  • Gene

    Coordinates
    1,524,791 1,525,000

    The protein

    Protein family

  • UPF0356 family (single member, according to UniProt)
  • Structure

  • [PDB|4NJC] [Pubmed|25092033]
  • [SW|Localization]

  • colocalizes with the nucleoid [Pubmed|25092033]
  • Expression and Regulation

    Operons

    genes
    [gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]-[gene|3EB289D0F58A58C693AB588798EE66A731341999|rnjA]
    description
    [Pubmed|24187087]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24187087], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE14540 ([gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAAATCTCTCCTTAA, downstream forward: _UP4_AAAGTATTGGAGTTATGAGC
  • BKK14540 ([gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAAATCTCTCCTTAA, downstream forward: _UP4_AAAGTATTGGAGTTATGAGC
  • Expression vectors

  • pGP2824: expression in ''B. subtilis'', with C-terminal Strep-tag, in [SW|pGP382], available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP420 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 25878038
  • Original publications

  • 24187087,20724389,25092033