SubtiBank SubtiBank
rpoY
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rpoY

epsilon subunit of [SW|RNA polymerase]
locus
BSU_14540
pI
4.61
mw
8.12 kDa
protein length
gene length
210 bp Sequence Blast
function
control of [SW|RNA polymerase] activity
product
epsilon subunit of [SW|RNA polymerase]
essential
no
synonyms
ykzG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.1|RNA polymerase]
  • Gene

    Coordinates
    1,524,791 1,525,000

    The protein

    Protein family

  • UPF0356 family (single member, according to UniProt)
  • Structure

  • [PDB|4NJC] [Pubmed|25092033]
  • [SW|Localization]

  • colocalizes with the nucleoid [Pubmed|25092033]
  • Expression and Regulation

    Operons

    genes
    [gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]-[gene|3EB289D0F58A58C693AB588798EE66A731341999|rnjA]
    description
    [Pubmed|24187087]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|24187087], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE14540 ([gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAAATCTCTCCTTAA, downstream forward: _UP4_AAAGTATTGGAGTTATGAGC
  • BKK14540 ([gene|5F41273FB867C688011738CD45AA6FF5D3987EFE|rpoY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAAATCTCTCCTTAA, downstream forward: _UP4_AAAGTATTGGAGTTATGAGC
  • Expression vectors

  • pGP2824: expression in ''B. subtilis'', with C-terminal Strep-tag, in [SW|pGP382], available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP420 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 25878038
  • Original publications

  • 24187087,20724389,25092033