SubtiBank SubtiBank
ycdC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycdC

unknown
locus
BSU_02800
pI
5.80
mw
52.04 kDa
protein length
453 aa Sequence Blast
gene length
1362 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    302,435 303,796

    Biological materials

    Mutant

  • MGNA-B980 (ycdC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1979 NBRP B. subtilis, Japan]
  • BKE02800 ([gene|5F2FE4CFA2709AE95708541922944E99E1A3FEB1|ycdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGTCATCCCTTTCA, downstream forward: _UP4_AAAAAGAAAAGGCTGTGAGG
  • BKK02800 ([gene|5F2FE4CFA2709AE95708541922944E99E1A3FEB1|ycdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGTCATCCCTTTCA, downstream forward: _UP4_AAAAAGAAAAGGCTGTGAGG