SubtiBank SubtiBank
rsbRC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbRC

probably part of the stressosome
locus
BSU_19450
pI
5.51
mw
31.96 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
control of SigB activity
product
RsbR paralog
essential
no
synonyms
yojH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    2,120,767 2,121,615

    The protein

    Paralogous protein(s)

  • [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB]
  • Modification

  • phosphorylation on Thr-186 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Expression and Regulation

    Operons

    genes
    [gene|692C2F92DBE9E917697A883DA66C6E0FA2DE3FBA|yojI]-[gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A323 (yojH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/323 NBRP B. subtilis, Japan]
  • BKE19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • BKK19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • References

  • 15312768,17726680,17726680,17218307,20019076,28271471,28727759