SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


probably part of the stressosome
31.96 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
control of SigB activity
RsbR paralog

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    2,120,767 2,121,615

    The protein

    Paralogous protein(s)

  • [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD], [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB]
  • [SW|Domains]

  • [SW|STAS domain] (aa 165-276) (according to UniProt)
  • Modification

  • phosphorylation on Thr-186 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A323 (yojH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • BKK19450 ([gene|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|rsbRC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTGCCATGATTGATCACC, downstream forward: _UP4_TAAGGCTTAAGGCCTTATAC
  • References

  • 15312768,17726680,17726680,17218307,20019076,28271471,28727759