lutC

lactate catabolic enzyme

Locus: BSU_34030

Isoelectric point: 5.16

Molecular weight: 26.13 kDa

Protein length: 240 aa

Gene length: 723 bp

Function: utilization of lactate

Product: unknown

Essential: no

Synonyms: yvbY

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of organic acids
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 3,492,797 3,493,519

Phenotypes of a mutant

• no growth with lactate as the single carbon source PubMed

The protein

Catalyzed reaction/ biological activity

• oxidation of lactate to pyruvate PubMed

Protein family

• LutC/YkgG family (single member, according to UniProt)

Modification

• phosphorylated on Arg-97 PubMed

Expression and Regulation

Operons

• Genes: lutA-lutB-lutC
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • SinR: repression, PubMed, in SinR regulon
  • LutR: repression, in LutR regulon

  Regulation

  • induction by lactate PubMed

Other regulations

• FsrA: translation repression, PubMed
• FbpB: translation inhibition, acts as RNA chaperone, increases interaction between FsrA and LutA-LutB-LutC RNAs

Biological materials

Mutant

• MGNA-A470 (yvbY::erm), available at the NBRP B. subtilis, Japan
• BKE34030 (lutC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG, downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA
• BKK34030 (lutC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG, downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage

References

Loading