SubtiBank SubtiBank
lutC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lutC

lactate catabolic enzyme
locus
BSU_34030
pI
5.16
mw
26.13 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
utilization of lactate
product
unknown
essential
no
synonyms
yvbY

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,492,797 3,493,519

    Phenotypes of a mutant

  • no growth with lactate as the single carbon source [Pubmed|19201793]
  • The protein

    Catalyzed reaction/ biological activity

  • oxidation of lactate to pyruvate [Pubmed|19201793]
  • Protein family

  • LutC/YkgG family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-97 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]
    description
    [Pubmed|19201793]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|25031425], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19201793], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: repression, in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • induction by lactate [Pubmed|19201793]
  • view in new tab

    Other regulations

  • [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|22427629]
  • [protein|147AFEBEA546FDBEEB08E9A8D9C7BCDC9B83CC90|FbpB]: translation inhibition, acts as RNA chaperone, increases interaction between [protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA] and [protein|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|LutA]-[protein|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|LutB]-[protein|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|LutC] RNAs
  • Biological materials

    Mutant

  • MGNA-A470 (yvbY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/470 NBRP B. subtilis, Japan]
  • BKE34030 ([gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG, downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA
  • BKK34030 ([gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTGAATGGTTCCCTTCG, downstream forward: _UP4_TGAACTCAGGAAGCCCGGCA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

  • 22427629,19201793,19201793,22517742