SubtiBank SubtiBank
ctpA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ctpA

carboxy-terminal processing protease, promotes DNA damage checkpoint recovery
locus
BSU_19590
pI
8.86
mw
50.98 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast
function
unknown
product
carboxy-terminal processing protease
essential
no
synonyms
yzbD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,131,902 2,133,302

    Phenotypes of a mutant

  • deletion of [protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA] and [protein|1A5C1BDE844AA56B90C0E4A02D74978676487E99|DdcP] leads to accumulation of the checkpoint protein [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] [pubmed|29979679]
  • sensitivity to DNA damage [pubmed|29979679]
  • The protein

    Catalyzed reaction/ biological activity

  • digestion of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] [pubmed|29979679]
  • The enzyme shows specific recognition of a C-terminal tripeptide, Xaa-Yaa-Zaa, in which Xaa is preferably Ala or Leu, Yaa is preferably Ala or Tyr, and Zaa is preferably Ala, but then cleaves at a variable distance from the C-terminus. A typical cleavage is -Ala-Ala-|-Arg-Ala-Ala-Lys-Glu-Asn-Tyr-Ala-Leu-Ala-Ala (according to UniProt).
  • Protein family

  • Peptidase s41a family (together with [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB], according to Uniprot)
  • Paralogous protein(s)

  • [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB]
  • [SW|Domains]

  • signal peptide (aa 1 - 36) [pubmed|29979679]
  • [SW|PDZ domain] (aa 96- 174) [pubmed|29979679]
  • S41 peptidase domain [pubmed|29979679]
  • peptidoglycan binding domain (C-terminal) [pubmed|29979679]
  • Structure

  • [PDB|4C2D] ([protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|CtpB], 42% identity) [pubmed|24243021]
  • [SW|Localization]

  • cell membrane, with extracellular protease domain [pubmed|30315724]
  • Expression and Regulation

    Operons

    genes
    [gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A087 (ctpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/87 NBRP B. subtilis, Japan]
  • 1A866 ( ''ctpA''::''cat''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A866&Search=1A866 BGSC]
  • BKE19590 ([gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAACACCACCTTTTT, downstream forward: _UP4_TAAAAAAAACCATACGCGGC
  • BKK19590 ([gene|5ED8301B9681FDD5171A9344A971E891493A6558|ctpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAACACCACCTTTTT, downstream forward: _UP4_TAAAAAAAACCATACGCGGC
  • References

  • 9734814,24243021,29979679,30315724