SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.67 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,352,312 3,352,686

    The protein


  • [SW|GIY-YIG-domain] (aa 42-118) (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B581 (yurQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32620 ([gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCAGTTCACGTCCTC, downstream forward: _UP4_TAAGACGTCAGTCTGCGGAT
  • BKK32620 ([gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCAGTTCACGTCCTC, downstream forward: _UP4_TAAGACGTCAGTCTGCGGAT
  • References

  • 21815947