SubtiBank SubtiBank
yurQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yurQ

unknown
locus
BSU_32620
pI
8.12
mw
14.67 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,352,312 3,352,686

    The protein

    [SW|Domains]

  • [SW|GIY-YIG-domain] (aa 42-118) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07DDC0BED23B30D0BF9273508C62B94D924468F6|yurR]-[gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B581 (yurQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1580 NBRP B. subtilis, Japan]
  • BKE32620 ([gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCAGTTCACGTCCTC, downstream forward: _UP4_TAAGACGTCAGTCTGCGGAT
  • BKK32620 ([gene|5E900FDB04EC45AC1DAEEFDCC342DF91303E502E|yurQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATCAGTTCACGTCCTC, downstream forward: _UP4_TAAGACGTCAGTCTGCGGAT
  • References

  • 21815947