SubtiBank SubtiBank
ypsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypsA

unknown
locus
BSU_22190
pI
4.47
mw
20.91 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,332,153 2,332,782

    Phenotypes of a mutant

  • increased susceptibility to hydrogen peroxide treatment [pubmed|31024470]
  • overexpression of YpsA interferes with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] assembly [pubmed|31024470]
  • The protein

    Protein family

  • SLOG superfamily of nucleotide and ligand-binding proteins [pubmed|31024470]
  • UPF0398 family (single member, according to UniProt)
  • Structure

  • [PDB|2NX2]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-A417 (ypsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/417 NBRP B. subtilis, Japan]
  • BKE22190 ([gene|5E5894ABD87B095191B109CEA9CEA89A5CA8A82D|ypsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCACCTGCTTTAA, downstream forward: _UP4_TAACAATGAGAGAGAAATTT
  • BKK22190 ([gene|5E5894ABD87B095191B109CEA9CEA89A5CA8A82D|ypsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCACCTGCTTTAA, downstream forward: _UP4_TAACAATGAGAGAGAAATTT
  • References

    Research papers

  • 31024470