SubtiBank SubtiBank
ysfE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ysfE

unknown
locus
BSU_28700
pI
4.32
mw
8.69 kDa
protein length
gene length
243 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,935,967 2,936,209

    The protein

    [SW|Domains]

  • [SW|VOC domain] (aa 1-78) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F93E473C06669DE604EC027236C79E5450F53720|cstA]-[gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.4-fold) ([protein|search|CcpA]) [Pubmed|12850135,22900538]
  • view in new tab

    genes
    [gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B026 (ysfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1025 NBRP B. subtilis, Japan]
  • BKE28700 ([gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCGTAGACCCTGTAT, downstream forward: _UP4_TAACGCACAAAAGCCCAAAA
  • BKK28700 ([gene|5E483479E65CF5E648A88F3B9029CCE555B27898|ysfE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATATCGTAGACCCTGTAT, downstream forward: _UP4_TAACGCACAAAAGCCCAAAA
  • References

  • 8969504,22383849,22900538