SubtiBank SubtiBank
yopX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yopX

unknown
locus
BSU_20730
pI
4.28
mw
15.05 kDa
protein length
134 aa Sequence Blast
gene length
405 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,201,980 2,202,384

    The protein

    Structure

  • [PDB|2I2L]
  • Biological materials

    Mutant

  • BKE20730 ([gene|5E397E19738F98881AFC878BC0131396B9041814|yopX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCAAACTCTGTATGCTG, downstream forward: _UP4_CCTGAGTTATTGGAGGGTGT
  • BKK20730 ([gene|5E397E19738F98881AFC878BC0131396B9041814|yopX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCCCAAACTCTGTATGCTG, downstream forward: _UP4_CCTGAGTTATTGGAGGGTGT