SubtiBank SubtiBank
fakA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fakA

fatty acid kinase
locus
BSU_15840
pI
4.28
mw
59.32 kDa
protein length
553 aa Sequence Blast
gene length
1662 bp Sequence Blast
function
phosphorylation of fatty acids
product
fatty acid kinase
essential
no
synonyms
yloV

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    1,656,442 1,658,103

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of fatty acids (bound to [protein|FB9ABF1FE4EC062C039A62B28A192BAA9B565EEF|DegV] or [protein|C13F1870B014F8B2C16D9B169F40747DE5B51B85|YitS]) [pubmed|30429218]
  • [SW|Domains]

  • DhaL domain (aa 9-201) (according to UniProt)
  • Modification

  • phosphorylated on Arg-255 [Pubmed|22517742]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU]-[gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|fakA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B137 (yloV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1136 NBRP B. subtilis, Japan]
  • GP1466 (''yloV''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP1467 (''[gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU] - yloV''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • BKE15840 ([gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|fakA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAGACAATCCTACTCCTC, downstream forward: _UP4_TAGAAGGGCAATTTGCCCTT
  • BKK15840 ([gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|fakA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATAGACAATCCTACTCCTC, downstream forward: _UP4_TAGAAGGGCAATTTGCCCTT
  • References

  • 22383849,17981983,22517742,28579978,30429218,29581406,32671874