SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


SEDS family peptidoglycan glycosyltransferase, required for spore cortex peptidoglycan synthesis
39.97 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
spore cortex peptidoglycan synthesis
SEDS family peptidoglycan glycosyltransferase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,590,317 1,591,417

    The protein

    Protein family

  • [SW|SEDS proteins] (shape, elongation, division, and sporulation) [Pubmed|27525505]
  • SEDS family (with [protein|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|FtsW] and [protein|B405B3C21B464F904BBB2AFD5DA21ADE45B4DD96|RodA], according to UniProt)
  • Paralogous protein(s)

  • [protein|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|FtsW], [protein|B405B3C21B464F904BBB2AFD5DA21ADE45B4DD96|RodA]
  • Structure

  • [PDB|6BAR] (from Thermus thermophilus,corresponds to aa 99... 357, 38% identity) [pubmed|29590088]
  • [SW|Localization]

  • integral membrane protein, forespore [Pubmed|17981970]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth [Pubmed|1391053]
  • view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab



  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE15210 ([gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAATCGACACCCCAA, downstream forward: _UP4_TAACGAATGTATTTCCAAGC
  • BKK15210 ([gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAATCGACACCCCAA, downstream forward: _UP4_TAACGAATGTATTTCCAAGC
  • References

  • 20417640,17981970,8320223,1391053,15383836,26883633,27525505,29590088