SubtiBank SubtiBank
ygzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ygzD

similar to transcription regulator ([SW|Xre family])
locus
BSU_08899
pI
7.83
mw
7.60 kDa
protein length
gene length
201 bp Sequence Blast
function
unknown
product
putative HTH-type transcriptional regulator
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    966,671 966,871

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 5-59) (according to UniProt)
  • Structure

  • [PDB|1UTX] (from Enterococcus faecalis, 41% identity) [pubmed|15359276]
  • Expression and Regulation

    Operons

    genes
    [gene|5DB65F7EE4EFADFB0B46C2EE5726D4B9FA9D85E9|ygzD]-[gene|FFC5766E471A155D3C5C0DB3A9DA46BE24781965|ygaO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE08899 ([gene|5DB65F7EE4EFADFB0B46C2EE5726D4B9FA9D85E9|ygzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08899 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGACGTCTGTCCCCT, downstream forward: _UP4_TTTTGGTTAGAGGAGGAAAA
  • BKK08899 ([gene|5DB65F7EE4EFADFB0B46C2EE5726D4B9FA9D85E9|ygzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08899 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGACGTCTGTCCCCT, downstream forward: _UP4_TTTTGGTTAGAGGAGGAAAA
  • References

  • 23504016,15359276